Review





Similar Products

90
Shanghai GenePharma mir29-x inhibitor
Mir29 X Inhibitor, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29-x inhibitor/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
mir29-x inhibitor - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Horita Co Inc mir29 family
Mir29 Family, supplied by Horita Co Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29 family/product/Horita Co Inc
Average 90 stars, based on 1 article reviews
mir29 family - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Millipore mir29 passenger strand: 30-accgauuucaga uggugugaau-50
Mir29 Passenger Strand: 30 Accgauuucaga Uggugugaau 50, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29 passenger strand: 30-accgauuucaga uggugugaau-50/product/Millipore
Average 90 stars, based on 1 article reviews
mir29 passenger strand: 30-accgauuucaga uggugugaau-50 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Millipore mir29 guide strand: 50-uagcaccaucugaaau cgguua-30
Mir29 Guide Strand: 50 Uagcaccaucugaaau Cgguua 30, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29 guide strand: 50-uagcaccaucugaaau cgguua-30/product/Millipore
Average 90 stars, based on 1 article reviews
mir29 guide strand: 50-uagcaccaucugaaau cgguua-30 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
OriGene primers specific for mir29s
Primers Specific For Mir29s, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers specific for mir29s/product/OriGene
Average 90 stars, based on 1 article reviews
primers specific for mir29s - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Mimetics for mir29s 29a-3p
For Mir29s 29a 3p, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/for mir29s 29a-3p/product/Mimetics
Average 90 stars, based on 1 article reviews
for mir29s 29a-3p - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Takeda mir29
Mir29, supplied by Takeda, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29/product/Takeda
Average 90 stars, based on 1 article reviews
mir29 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co synthetic oligonucleotide inhibitor targeting rno-mir-29 (anti-mir29)
Synthetic Oligonucleotide Inhibitor Targeting Rno Mir 29 (Anti Mir29), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic oligonucleotide inhibitor targeting rno-mir-29 (anti-mir29)/product/Ribobio co
Average 90 stars, based on 1 article reviews
synthetic oligonucleotide inhibitor targeting rno-mir-29 (anti-mir29) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co mir29-specific rt primer
Mir29 Specific Rt Primer, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir29-specific rt primer/product/Ribobio co
Average 90 stars, based on 1 article reviews
mir29-specific rt primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Mimetics mimetics for mir29s
( A ) miRs alteration in the kidneys of the diabetic and non-diabetic CD-1 and 129Sv mice, as analyzed by microRNA array analysis. N = 3 in case of control kidneys while N = 3 were analyzed in diabetic kidneys of each mouse strain. ( B ) qPCR analysis of <t>miR-29a-3p.</t> ( C ) <t>miR-29b-3p.</t> ( D ) <t>miR-29c-3p.</t> ( E ) miR-29a-5p. ( F ) miR-29b-5p. ( G ) miR-29c-5p. ( H ) miR-let-7b-3p. ( I ) miR-let-7b-5p. ( J ) miR-let-7c-3p. ( K ) miR-let-7c-5p. ( L ) miR-let-7f-3p. ( M ) miR-let-7g-3p. ( N ) miR-let-7i-3p. N = 5 were analyzed in each data set. The data are expressed as the means ± s.e.m and are included in the graph. Hs_RNU6 was used as internal control. Diabetic mice are designated as DM in the figure.
Mimetics For Mir29s, supplied by Mimetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mimetics for mir29s/product/Mimetics
Average 90 stars, based on 1 article reviews
mimetics for mir29s - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


( A ) miRs alteration in the kidneys of the diabetic and non-diabetic CD-1 and 129Sv mice, as analyzed by microRNA array analysis. N = 3 in case of control kidneys while N = 3 were analyzed in diabetic kidneys of each mouse strain. ( B ) qPCR analysis of miR-29a-3p. ( C ) miR-29b-3p. ( D ) miR-29c-3p. ( E ) miR-29a-5p. ( F ) miR-29b-5p. ( G ) miR-29c-5p. ( H ) miR-let-7b-3p. ( I ) miR-let-7b-5p. ( J ) miR-let-7c-3p. ( K ) miR-let-7c-5p. ( L ) miR-let-7f-3p. ( M ) miR-let-7g-3p. ( N ) miR-let-7i-3p. N = 5 were analyzed in each data set. The data are expressed as the means ± s.e.m and are included in the graph. Hs_RNU6 was used as internal control. Diabetic mice are designated as DM in the figure.

Journal: Scientific Reports

Article Title: Effect of Antifibrotic MicroRNAs Crosstalk on the Action of N-acetyl-seryl-aspartyl-lysyl-proline in Diabetes-related Kidney Fibrosis

doi: 10.1038/srep29884

Figure Lengend Snippet: ( A ) miRs alteration in the kidneys of the diabetic and non-diabetic CD-1 and 129Sv mice, as analyzed by microRNA array analysis. N = 3 in case of control kidneys while N = 3 were analyzed in diabetic kidneys of each mouse strain. ( B ) qPCR analysis of miR-29a-3p. ( C ) miR-29b-3p. ( D ) miR-29c-3p. ( E ) miR-29a-5p. ( F ) miR-29b-5p. ( G ) miR-29c-5p. ( H ) miR-let-7b-3p. ( I ) miR-let-7b-5p. ( J ) miR-let-7c-3p. ( K ) miR-let-7c-5p. ( L ) miR-let-7f-3p. ( M ) miR-let-7g-3p. ( N ) miR-let-7i-3p. N = 5 were analyzed in each data set. The data are expressed as the means ± s.e.m and are included in the graph. Hs_RNU6 was used as internal control. Diabetic mice are designated as DM in the figure.

Article Snippet: The HMVECs were transfected with 100 nM of antagomir for miR-29a, miR-29c (Fasmac, Japan), miR-29b inhibitor (Qiagen), or mimetics for miR29s (29a-3p: UAGCACCAUCUGAAAUCGGUUA, 29b-3p: UAGCACCAUUUGAAAUCAGUGUU, 29c-3p: UAGCACCAUUUGAAAUCGGUUA) using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.

Techniques: Control

( A–K ) miR-29s and miR-let-7s emerged as important regulatory antifibrotic molecules, as validated by real-time PCR using specific primers in the kidneys of the control, diabetic and AcSDKP treatment. ( A ) qPCR analysis of miR-29a-3p. ( B ) miR-29b-3p. ( C ) miR-29c-3p. ( D ) miR-29a-5p. ( E ) miR-29b-5p. ( F ) miR-29c-5p. ( G ) miR-let-7b-3p. ( H ) miR-let-7c-3p. ( I ) miR-let-7f-3p. ( J ) miR-let-7b-5p. ( K ) miR-let-7c-5p. N = 5 were analyzed. ( L–U ) qPCR analysis in the kidneys of control, diabetic and linagliptin-treated mice ( L ) miR-29a-5p. ( M ) miR-29b-5p. ( N ) miR-29c-5p. ( O ) miR-let-7b-3p. ( P ) miR-let-7c-3p. ( Q ) miR-let-7f-3p. ( R ) miR-let-7g-3p. ( S ) miR-let-7i-3p. ( T ) miR-let-7b-5p. ( U ) miR-let-7c-5p. N = 5 in case of control whereas N = 6 in case of diabetic and linagliptin treated diabetic kidneys were analyzed. Hs_RNU6 was used as internal control to normalize the data. The data are expressed as the means ± s.e.m and are included in the graph. Diabetic mice are designated as DM in the figure.

Journal: Scientific Reports

Article Title: Effect of Antifibrotic MicroRNAs Crosstalk on the Action of N-acetyl-seryl-aspartyl-lysyl-proline in Diabetes-related Kidney Fibrosis

doi: 10.1038/srep29884

Figure Lengend Snippet: ( A–K ) miR-29s and miR-let-7s emerged as important regulatory antifibrotic molecules, as validated by real-time PCR using specific primers in the kidneys of the control, diabetic and AcSDKP treatment. ( A ) qPCR analysis of miR-29a-3p. ( B ) miR-29b-3p. ( C ) miR-29c-3p. ( D ) miR-29a-5p. ( E ) miR-29b-5p. ( F ) miR-29c-5p. ( G ) miR-let-7b-3p. ( H ) miR-let-7c-3p. ( I ) miR-let-7f-3p. ( J ) miR-let-7b-5p. ( K ) miR-let-7c-5p. N = 5 were analyzed. ( L–U ) qPCR analysis in the kidneys of control, diabetic and linagliptin-treated mice ( L ) miR-29a-5p. ( M ) miR-29b-5p. ( N ) miR-29c-5p. ( O ) miR-let-7b-3p. ( P ) miR-let-7c-3p. ( Q ) miR-let-7f-3p. ( R ) miR-let-7g-3p. ( S ) miR-let-7i-3p. ( T ) miR-let-7b-5p. ( U ) miR-let-7c-5p. N = 5 in case of control whereas N = 6 in case of diabetic and linagliptin treated diabetic kidneys were analyzed. Hs_RNU6 was used as internal control to normalize the data. The data are expressed as the means ± s.e.m and are included in the graph. Diabetic mice are designated as DM in the figure.

Article Snippet: The HMVECs were transfected with 100 nM of antagomir for miR-29a, miR-29c (Fasmac, Japan), miR-29b inhibitor (Qiagen), or mimetics for miR29s (29a-3p: UAGCACCAUCUGAAAUCGGUUA, 29b-3p: UAGCACCAUUUGAAAUCAGUGUU, 29c-3p: UAGCACCAUUUGAAAUCGGUUA) using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.

Techniques: Real-time Polymerase Chain Reaction, Control

( A–C ) Gene expression studies by qPCR analysis of miR-29s after transfection of scramble control and mimetic constructs (mim-miR-let-7b and mim-miR-let-7c) in the presence of TGFβ2 in the HMVECs. ( A ) miR-29a-3p. ( B ) miR-29b-3p. ( C ) miR-29c-3p. N = 5 were analyzed in data set. ( D–F ) Gene expression studies by qPCR analysis of miR-let-7s after transfection of scramble control and mimetic constructs (mim-miR-29a, mim-miR-29b and mim-miR-29c) in the presence of TGFβ2 in the HMVECs. ( D ) miR-let-7b-3p ( E ) miR-let-7c-3p. ( F ) miR-let-7f-3p. N = 6 were analyzed in data set. ( G–I ) Gene expression analysis of miR-29s after the transfection of scramble control, antagomirs (anti-miR-let-7b and anti-miR-let-7c) and TGFβ2 treated scramble control in the HMVECs. ( G ) miR-29a-3p ( H ) miR-29b-3p. ( I ) miR-29c-3p. N = 5 were analyzed in each data set. ( J-L ) Gene expression analysis of miR-let-7s after the transfection of scramble control, antagomirs (anti-miR-29a, anti-miR-29b and anti-miR-29c) and TGFβ2 treated scramble control in the HMVECs. ( J ) miR-let-7b-3p. ( K ) miR-let-7c-3p. ( L ) miR-let-7f-3p. N = 6 were analyzed in each data set. Hs_RNU6 was used as internal control. The data are expressed as the means ± s.e.m and are included in the graph.

Journal: Scientific Reports

Article Title: Effect of Antifibrotic MicroRNAs Crosstalk on the Action of N-acetyl-seryl-aspartyl-lysyl-proline in Diabetes-related Kidney Fibrosis

doi: 10.1038/srep29884

Figure Lengend Snippet: ( A–C ) Gene expression studies by qPCR analysis of miR-29s after transfection of scramble control and mimetic constructs (mim-miR-let-7b and mim-miR-let-7c) in the presence of TGFβ2 in the HMVECs. ( A ) miR-29a-3p. ( B ) miR-29b-3p. ( C ) miR-29c-3p. N = 5 were analyzed in data set. ( D–F ) Gene expression studies by qPCR analysis of miR-let-7s after transfection of scramble control and mimetic constructs (mim-miR-29a, mim-miR-29b and mim-miR-29c) in the presence of TGFβ2 in the HMVECs. ( D ) miR-let-7b-3p ( E ) miR-let-7c-3p. ( F ) miR-let-7f-3p. N = 6 were analyzed in data set. ( G–I ) Gene expression analysis of miR-29s after the transfection of scramble control, antagomirs (anti-miR-let-7b and anti-miR-let-7c) and TGFβ2 treated scramble control in the HMVECs. ( G ) miR-29a-3p ( H ) miR-29b-3p. ( I ) miR-29c-3p. N = 5 were analyzed in each data set. ( J-L ) Gene expression analysis of miR-let-7s after the transfection of scramble control, antagomirs (anti-miR-29a, anti-miR-29b and anti-miR-29c) and TGFβ2 treated scramble control in the HMVECs. ( J ) miR-let-7b-3p. ( K ) miR-let-7c-3p. ( L ) miR-let-7f-3p. N = 6 were analyzed in each data set. Hs_RNU6 was used as internal control. The data are expressed as the means ± s.e.m and are included in the graph.

Article Snippet: The HMVECs were transfected with 100 nM of antagomir for miR-29a, miR-29c (Fasmac, Japan), miR-29b inhibitor (Qiagen), or mimetics for miR29s (29a-3p: UAGCACCAUCUGAAAUCGGUUA, 29b-3p: UAGCACCAUUUGAAAUCAGUGUU, 29c-3p: UAGCACCAUUUGAAAUCGGUUA) using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.

Techniques: Gene Expression, Transfection, Control, Construct